rs4394780 chr10:46229240 T>C
- Sequence
gagcaaaggtcagatatacaccca[T/C]gcgcttatgccacagccagtagtt
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
- ASB for transcription factors
- EGR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | -2.51 | 2.08 | 1.50 | 4.12 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (geographic atrophy), obesity with early age of onset (age >2), tardive dyskinesia