rs440746 chr3:11847082 G>T
- Sequence
ctccgcgggccctgagccttgata[G/T]cctctgtacttctctcttcaaact
- ASB in cell types
- T47D (invasive ductal carcinoma) MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | -0.53 | 1.41 | 2.12 | |||
| MM1.S (plasma cell myeloma) | 1.20 | -0.05 | 1.39 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), barnes akathisia rating scale, chronic kidney disease, hypertension, gender differentiated, partial epilepsy, waist circumference in type 2 diabetes
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood