rs4410871 chr8:127802783 T>C
- Sequence
gaaaccgttgccatcttcgggaag[T/C]ttccagtgtgggagggaggcacac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | n/a | 3.12 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP multiple sclerosis, neuroblastoma (brain cancer), premature ovarian failure, primary rhegmatogenous retinal detachment, rheumatoid arthritis
PheWAS abnormal findings on study of brain, nervous system, abnormal thyroid function, adverse effects of antirheumatics, adverse effects of sedatives or other central nervous system depressants and anesthetics, alcoholic liver damage, allergic conjunctivitis, anemia in neoplastic disease, aphasia/speech disturbance, arterial embolism and thrombosis of lower extremity artery, arthropathy nos involving multiple sites, ascites (non malignant), cancer of brain and nervous system, cancer of kidney and renal pelvis, cardiomyopathy, cerebral aneurysm, cervicitis and endocervicitis, cholesteatoma, chronic ulcer of leg or foot, coma, stupor, and brain damage, congenital anomalies of limbs, congenital deformities of feet, corneal dystrophy, cystoid macular degeneration of retina, disease of capillaries, disorders of cornea, disorders of lipoid metabolism, disorders of menstruation, disorders of the globe, disturbances of amino-acid transport, disturbances of sulphur-bearing amino-acid metabolism, diverticulum of esophagus, acquired, emphysema, endometriosis, flat foot, fracture of clavicle or scapula, fracture of lower limb, fracture of neck of femur, fuchs dystrophy, generalized convulsive epilepsy, hemorrhage from gastrointestinal ulcer, hyperglyceridemia, hyperlipidemia, hypertrophy of female genital organs, hypotony of eye, inflammatory disease of breast, inflammatory diseases of female pelvic organs, irregular menstrual cycle/bleeding, joint/ligament sprain, malignant neoplasm of renal pelvis, musculoskeletal symptoms referable to limbs, other cardiac conduction disorders, other disorders of bone and cartilage, other disorders of middle ear and mastoid, other disorders of the nervous system, other hereditary hemolytic anemias, other specified diseases of sebaceous glands, otitis externa, pancreatic cancer, paroxysmal supraventricular tachycardia, periapical abscess, postinflammatory pulmonary fibrosis, primary/intrinsic cardiomyopathies, prurigo, renal cell carcinoma, rheumatoid arthritis, rheumatoid arthritis & related inflammatory polyarthropathies, sexual and gender identity disorders, sleep disorders, sleep related movement disorders, spondylolisthesis, congenital, supraventricular premature beats, symptomatic menopause, symptoms involving nervous and musculoskeletal systems, toxic erythema, transient alteration of awareness, type 2 diabetic ketoacidosis, uveitis, vascular disorders of kidney/hypertrophy, viral warts & hpv