rs4411444 chr14:80978764 A>G
- Sequence
gagtggtgcatctctgtggctgcc[A/G]tacccattttctctttcatcttct
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
- ASB for transcription factors
- PBX1_HUMAN TFE2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX1_HUMAN | 2.39 | -2.64 | 1.33 | n/a | No Hit | |||
| TFE2_HUMAN | 2.09 | -2.33 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, hdl cholesterol, prop taste detection threshold
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Testis, Thyroid, Whole_Blood