rs441810 chr21:41326980 A>G
- Sequence
ggcctggtgccctttgatcattgc[A/G]aaggctcccagtgcctgttggtgc
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.09 | -0.63 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, esophageal squamous cell carcinoma (esophageal cancer), hdl cholesterol, partial epilepsy, plasma carcinoembryonic antigen (cea) levels, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Colon_Transverse, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood