rs442103 chr8:26571540 T>C
- Sequence
ggtgcagggtgggcattgcaggag[T/C]tcttcaggaggtgtgtgcgctaac
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells)
- ASB for transcription factors
- ZN143_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | -1.89 | 2.01 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, fasting insulin, height, homa-b, homa-ir, recurrent early onset major depressive disorder (males)
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Stomach, Thyroid