rs442253 chr5:173591369 T>C
- Sequence
agtgggcctgagagccatggctct[T/C]ctaggagacatatgaaatcagcat
- ASB in cell types
- T47D (invasive ductal carcinoma) breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.62 | 1.67 | 2.50 | n/a | No Hit | |||
| FOXA1_HUMAN | -2.29 | 1.41 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, comorbid depressive syndrome and alcohol dependence, late onset alzheimers disease, total cholesterol