rs442352 chr7:134141192 T>C
- Sequence
ttcgtcaactgtttgaaagcctcc[T/C]gtgtgtaaagtaccgcatatgttt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.07 | 0.62 | 1.52 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, hdl cholesterol, hdl cholesterol change with statins, height, total cholesterol change with statins
GTEx eQTL Artery_Aorta, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis