rs4423679 chr20:62447580 G>C
- Sequence
ctaagcagctcgccccacccagcc[G/C]gtcctgcctgctctgtccctccca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.14 | 0.86 | 1.97 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Mucosa, Minor_Salivary_Gland, Testis, Thyroid