rs445971 chr16:77963812 T>G
- Sequence
ttggggaagccatgggaaagtgat[T/G]ttcacttctctgtgatacttccca
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.68 | -0.78 | 1.42 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, eye color, hip bone mineral density (bmd), primary rhegmatogenous retinal detachment, spine bone mineral density (bmd)