rs4466386 chr8:41822335 T>C
- Sequence
actcagcccaggattggcatagct[T/C]tgcactggaagacagcacgcttgt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.80 | -0.22 | 2.04 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, college completion, fasting blood glucose, homa-b, ldl cholesterol, major depressive disorder, mean corpuscular hemoglobin concentration (mchc), schizophrenia
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Nerve_Tibial