rs446975 chr3:9175699 G>T
- Sequence
tttgtggagttgagcctgtgccag[G/T]tctacattctttctgttctagacc
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.57 | 1.13 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, cognitive response of healthy volunteers to topiramate treatment as measure by the digit span backward cognitive test, epilepsy, fasting insulin, longstanding arthritis, premature ovarian failure, sporadic creutzfeldt-jakob disease