rs447990 chr4:87112200 T>G
- Sequence
cctgaagtctccaggaaatcatgt[T/G]tgacaagtgggtattgtgtgctaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.30 | 0.89 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP common carotid artery thickness (average of near and far wall measures), hdl cholesterol, internal carotid artery thickness (average of near and far walls), ldl cholesterol, triglycerides, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Thyroid