rs448012 chr5:180619344 G>C
- Sequence
cttgagctccgacatcagcgcgcg[G/C]tgctcgctggccgtggcgccctct
- ASB in cell types
- A549 (lung carcinoma) hepatocytes MCF7 (Invasive ductal breast carcinoma) erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.10 | -0.24 | 2.00 | |||
| hepatocytes | -0.63 | 1.25 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -1.69 | 1.93 | 1.33 | |||
| erythroid cells | -1.71 | 1.92 | 2.00 | |||
| neural cell | 0.14 | 0.54 | 1.00 |
Items per page:
1 – 5 of 5