rs4495864 chr11:100757500 A>C
- Sequence
gagatggctgtagtaagtcaatct[A/C]ttaaaagtggaacacttggaagtt
- ASB in cell types
- BT-474 (breast invasive ductal carcinoma)
- ASB for transcription factors
- ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERR1_HUMAN | -0.79 | 1.24 | 2.12 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), diastolic blood pressure (dbp), serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid