rs450947 chr7:151350056 G>A
- Sequence
caccggacagggggcctttccctt[G/A]taggtagacgaggcggagagagag
- ASB in cell types
- 22RV1 (prostate carcinoma) HepG2 (hepatoblastoma)
- ASB for transcription factors
- SRF_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | -1.78 | 1.57 | 1.33 | 3.56 | Concordant | |||
| CREB1_HUMAN | 1.37 | -0.54 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Whole_Blood