rs453532 chr1:25037216 A>C
- Sequence
aggcctggtatacagtaagggctc[A/C]ataaatgttagctgaataagtgaa
- ASB in cell types
- GM12878 (female B-cells) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.07 | 0.86 | 1.31 | |||
| SK-N-SH (neuroblastoma) | 1.42 | -1.70 | 1.33 |
Items per page:
1 – 2 of 2