rs454421 chr19:45341392 C>T
- Sequence
aattggattgctggtagcacttta[C/T]gaccaagagctagtgcgactgtag
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.16 | 0.96 | 1.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hdl cholesterol change with statins, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), total cholesterol, variant creutzfeldt-jakob disease
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg