rs45451491 chr16:10924013 G>A
- Sequence
ctggttcagggttggcccctgccc[G/A]gctgcggaatgaaccacatcttgc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- NFIA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIA_HUMAN | n/a | 2.75 | 2.50 | 4.32 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
