rs4545285 chr1:232600503 A>G
- Sequence
ttatgagtgtgaagggatgaggaa[A/G]ctgggttactagggtgactgagaa
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 2.88 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, diastolic blood pressure (dbp), eye color, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio