rs455975 chr5:146662328 G>A
- Sequence
agatatccatagaatgtcagttct[G/A]cctcccaccaacagatggcagtag
- ASB in cell types
- pancreas NB69 (neuroblastoma) tibial artery thoracic aorta
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.46 | 0.15 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1