rs45601235 chr13:46387106 A>C
- Sequence
ccctctccaccccgcgccgctccc[A/C]tctcgcccccggccccgccagcct
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.75 | 0.14 | 1.33 | |||
| HEK293 (embryonic kidney) | 0.33 | 0.65 | 2.00 | |||
| HEK293T (embryonic kidney) | 1.28 | -0.60 | 2.00 |
Items per page:
1 – 3 of 3