rs4560589 chr5:162324577 C>T
- Sequence
tttgggaagctttaatttaggaga[C/T]tagctatttccaaacagcctgaga
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | -0.26 | 1.19 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension, combined control dataset, intracranial aneurysm, schizophrenia, waist circumference in type 2 diabetes