rs4568 chr14:24290803 G>A
- Sequence
gctgctgtttcactgagacaggac[G/A]aaccaccaagtccaaatgagaaga
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.08 | 0.76 | 1.72 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, alcohol dependence, alcohol dependence (early age of onset), apob (apolipoprotein b), comorbid depressive syndrome and alcohol dependence, ldl cholesterol, lp-pla2 mass, parkinsons disease, rheumatoid arthritis
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood