rs458502 chr20:479076 T>C
- Sequence
cttcattcaatcagaaacttgact[T/C]gtacccgttgaaaacctgtcatgt
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.51 | -0.01 | 2.01 | |||
| HEK293T (embryonic kidney) | -0.49 | 1.18 | 2.17 |
Items per page:
1 – 2 of 2