rs4592506 chr12:124867632 G>A
- Sequence
taaaaaggaatgaagggctgacgc[G/A]tgctacaccatggatgaaccttga
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.06 | -0.06 | 2.05 | |||
| HepG2 (hepatoblastoma) | 0.20 | 0.69 | 1.31 | |||
| HEK293 (embryonic kidney) | 0.57 | 0.07 | 1.96 |
Items per page:
1 – 3 of 3