rs460649 chr5:56270879 G>T
- Sequence
gatctcatatgctttaccacaagc[G/T]cacttttgacttcaagacagtttg
- ASB in cell types
- foreskin keratinocyte H929 (plasma cell myeloma) periferal blood macrophages B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.52 | n/a | 2.33 | |||
| H929 (plasma cell myeloma) | n/a | 2.29 | 2.00 | |||
| periferal blood macrophages | 1.12 | -0.25 | 2.00 | |||
| B-cells | 1.76 | -1.61 | 2.00 |
Items per page:
1 – 4 of 4