rs461251 chr17:715922 A>G
- Sequence
agccagatcaccgatcaccctgtg[A/G]aaccacctttcctgcagacactga
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.32 | 0.65 | 1.76 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, comorbid depressive syndrome and alcohol dependence, cystatin c in serum, height, hypertension (early onset hypertension), parkinsons disease
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood