rs4616261 chr15:75672828 C>T
- Sequence
cccagacattcctgaacacttgca[C/T]atgggttggctgttatctccagcg
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.45 | 0.37 | 1.37 | |||
| K562 (myelogenous leukemia) | 0.79 | -0.33 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, obesity with early age of onset (age >2), variant creutzfeldt-jakob disease, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood