rs463452 chr21:38853941 A>T
- Sequence
atgaggaaatgacactgcagtgac[A/T]ataactaatttgctcaggatcaca
- ASB in cell types
- primary endothelial colony-forming cells coronary artery smooth muscle
- ASB for transcription factors
- TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | -3.07 | 2.41 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1