rs4637174 chr2:48733178 A>G
- Sequence
attccagaatctttattgctgggg[A/G]taatgcagtgcagaacatattttg
- ASB in cell types
- VCaP (prostate carcinoma) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.37 | -0.26 | 2.00 | |||
| HEK293T (embryonic kidney) | -0.50 | 1.51 | 2.00 |
Items per page:
1 – 2 of 2