rs464331 chr20:479010 T>A
- Sequence
tgtaatttgctacagtgcaaaata[T/A]ctggctttccatagagggagtggg
- ASB in cell types
- HEK293 (embryonic kidney) PC9 (lung adenocarcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.57 | -0.12 | 2.05 | |||
| PC9 (lung adenocarcinoma) | -1.10 | 1.71 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.47 | 0.55 | 1.26 |
Items per page:
1 – 3 of 3