rs4646993 chr17:48604242 G>C
- Sequence
agcttaaaaaggcgacttagagct[G/C]gtctcctggccctcttttgattcc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZXDB_HUMAN ZBT20_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZXDB_HUMAN | 2.34 | n/a | 2.00 | n/a | n/a | |||
| ZBT20_HUMAN | 2.24 | -3.20 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), height, ldl cholesterol, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Testis, Thyroid, Whole_Blood