rs465002 chr5:56512648 C>T
- Sequence
ttatgggatatagaaggccagcat[C/T]cagggcctccacccataacagcca
- ASB in cell types
- hMADS-3 (adipose-derived stem cells)
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | -0.90 | 1.45 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI hdl cholesterol levels, hdl cholesterol levels in current drinkers, hdl cholesterol levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df), hdl cholesterol levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df), triglyceride levels, triglyceride levels in current drinkers, triglyceride levels x alcohol consumption (drinkers vs non-drinkers) interaction (2df), triglyceride levels x alcohol consumption (regular vs non-regular drinkers) interaction (2df)