rs4652583 chr1:181189949 T>A
- Sequence
tacagactagcagtcccttcggtg[T/A]tacgcccttccttccaccttctct
- ASB in cell types
- foreskin keratinocyte GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.71 | 2.50 | |||
| GM12878 (female B-cells) | 0.53 | 0.40 | 1.26 |
Items per page:
1 – 2 of 2