rs4660585 chr1:41927330 G>A
- Sequence
gtgtactctggctaaacaaactct[G/A]tatgtgtgttttgggggtggggtg
- ASB in cell types
- LNCaP (prostate carcinoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 0.94 | -0.18 | 1.50 | |||
| liver | 1.00 | -0.17 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), height, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Liver, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Thyroid, Whole_Blood