rs4674036 chr2:200405815 A>G
- Sequence
ggctgcttgattgctgtccttatc[A/G]taggggataaggttaagctcacct
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.72 | -0.27 | 1.97 | |||
| HEK293 (embryonic kidney) | 0.42 | 0.48 | 1.28 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism, bipolar disorder, diabetic retinopathy in type 2 diabetes mellitus, microalbuminuria, systolic blood pressure (sbp), years of education
GTEx eQTL Adipose_Subcutaneous, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid