rs4676939 chr3:73609334 C>A
- Sequence
tctgtttaaggctggtcaatgtga[C/A]ctttaaatcaaaaaagtagaagtg
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | 2.14 | -1.62 | 2.00 | -3.98 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting insulin, hip bone mineral density (bmd), irinotecan-related severe toxicities in treatment of non-small-cell lung cancer (grade 4 neutropenia), irritible bowel syndrome, ldl cholesterol, spine bone mineral density (bmd)