rs468141 chr3:13461558 A>C
- Sequence
gttttacttaaaaccaaaccctca[A/C]gtctctctaattgtacacttgcaa
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma) foreskin keratinocyte H929 (plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.22 | 0.83 | 1.41 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, ldl cholesterol, microalbuminuria, refractive error, sporadic creutzfeldt-jakob disease, tardive dyskinesia, triglycerides, years of education
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen