rs470080 chr22:39316363 C>T
- Sequence
ggtggccctcaccacatggggttg[C/T]actcagcacttgagatcagccagg
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.15 | 0.64 | 1.50 | -2.08 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Heart_Left_Ventricle, Liver, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood