rs471488 chr13:75219976 G>T
- Sequence
gagcagagcctgcgcgctaactgt[G/T]catcatttagtcaagagggcgtct
- ASB in cell types
- erythroid cells foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 3.11 | 1.50 | |||
| foreskin keratinocyte | 0.44 | n/a | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, sporadic creutzfeldt-jakob disease, stabilized warfarin dose