rs4716908 chr7:155768316 T>C
- Sequence
tggagtcattgccaaaccagctaa[T/C]ttctgtcttgtcttttaaattgaa
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.59 | 0.11 | 1.51 | |||
| HEK293 (embryonic kidney) | -0.33 | 0.43 | 2.00 | |||
| PC9 (lung adenocarcinoma) | 1.97 | -0.74 | 3.33 |
Items per page:
1 – 3 of 3