rs471716 chr6:16763010 G>A
- Sequence
ataaataaaaataaacatacgagc[G/A]aggaaggtgcagagccccggaaat
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.89 | 0.87 | 2.96 | |||
| foreskin keratinocyte | 2.10 | -0.88 | 2.17 | |||
| GM12878 (female B-cells) | 0.77 | 0.65 | 1.33 |
Items per page:
1 – 3 of 3