rs4720928 chr7:768365 T>C
- Sequence
acacgtgatcctggcggaagtgtc[T/C]gtgctgtgagccgcagctcacact
- ASB in cell types
- SK-N-SH (neuroblastoma) A-673 clone Asp114 (Ewing sarcoma) 501Mel-Cl8 (melanoma) Tet21N (neuroblastoma)
- ASB for transcription factors
- USF1_HUMAN FLI1_HUMAN MAX_HUMAN GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| USF1_HUMAN | 2.88 | -3.00 | 2.00 | n/a | No Hit | |||
| FLI1_HUMAN | n/a | 2.82 | 1.33 | n/a | No Hit | |||
| MAX_HUMAN | 1.87 | -0.47 | 1.67 | n/a | No Hit | |||
| GABPA_HUMAN | 2.36 | -2.72 | 2.00 | n/a | No Hit | |||
| MYCN_HUMAN | 1.56 | -0.83 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood