rs4726178 chr7:152575262 C>T
- Sequence
aaacctgaaagcttatctcttggt[C/T]gatgaaaagtctttgtactgtgga
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.49 | n/a | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, alzheimers disease, fasting serum igfbp-3 (ng/ml) in children, ldl cholesterol, ldl cholesterol change with statins, sporadic creutzfeldt-jakob disease, total cholesterol, total cholesterol change with statins