rs4730148 chr7:106176882 C>T
- Sequence
gggcagtgtggccccacgtggctc[C/T]gaagccctctgattctgcatgagg
- ASB in cell types
- SK-N-SH (neuroblastoma) skeletal muscles and myoblasts MCF7 (Invasive ductal breast carcinoma) CD34+ hematopoietic stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | -0.42 | 1.25 | 2.00 | |||
| skeletal muscles and myoblasts | 1.24 | -1.01 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.53 | 0.52 | 1.51 | |||
| CD34+ hematopoietic stem cells | 2.17 | -3.00 | 2.00 |
Items per page:
1 – 4 of 4