rs4731799 chr7:131513416 G>A
- Sequence
tggagcagaagggagtggtgggaa[G/A]ggggctgatggctgcatcccgtac
- ASB in cell types
- HEK293 (embryonic kidney) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.36 | 0.81 | 1.96 | |||
| epithelial cell of prostate | -1.03 | 1.20 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Stomach, Testis, Thyroid