rs473301 chr3:196970018 G>A
- Sequence
caccaccgcgtcccggccgctgga[G/A]cttcccgcccgcgccgccggcccg
- ASB in cell types
- T47D (invasive ductal carcinoma) HepG2 (hepatoblastoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | -0.90 | 1.81 | 4.29 | |||
| HepG2 (hepatoblastoma) | 0.41 | 0.56 | 1.27 | |||
| foreskin keratinocyte | 0.42 | n/a | 2.33 |
Items per page:
1 – 3 of 3