rs4735085 chr8:109064183 A>C
- Sequence
ttatccccaaactgccacgtacaa[A/C]taggcctgccatctgctttagcta
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts K562 (myelogenous leukemia)
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | n/a | 2.68 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, ldl cholesterol change with statins, total cholesterol change with statins, urinary albumin-to-creatinine ratio