rs473773 chr1:189658053 C>T
- Sequence
atgtggctgtcattataggctgta[C/T]ggacgctcacccagaaagtatttg
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 1.04 | -0.16 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1